Home    About    Publications    Services    Contact   
   
    Home     About     Articles     Conferences     Services     Contact     Search  
Login Login
Print Friendly Print Friendly
  Home > Publications > GCIRC > 493

Previous PageTable Of ContentsNext Page

MOLECULAR CONTROL OF MALE FERTILITY IN BRASSICA

Prem L. Bhalla and Mohan B. Singh.

Plant Molecular Biology and Biotechnology Research Laboratory, Institute of Land and Food Resources, The University of Melbourne, Parkville, Victoria 3052, Australia

ABSTRACT

Male sterility is important for the production of F1 hybrid seed. In order to produce hybrid seed uncontaminated with selfed seed pollination, control methods must be implemented to ensure cross-pollination. The molecular approach has the advantage that the hybridisation system can be imposed on all breeding lines or cultivars without the need for extensive backcrossing and disruption of established inbred lines, leading to the rapid production of male sterile lines with well characterised and superior agronomic performance. We are attempting to generate nuclear male sterile lines in Brassica crops by manipulating genes that are essential for the production of viable pollen grains. For this perturbing the Bcp1 gene expression using antisense approach was explored. Bcp1, an anther specific gene from Brassica, is active in both diploid tapetum and haploid microspores. For introduction of antisense Bcp1 construct, Brassica seedlings explants were inoculated and cocultivated with Agrobacterium tumefaciens harbouring a binary vector carrying antisense Bcp1 under control of an anther specific promoter along with the neomycin phosphotransferase-II gene, permitting transformed shoots to be selected on kanamycin containing medium. Rooted transformed plantlets were successfully obtained and grown under glasshouse conditions. Analysis of transgenic plants showed male sterility phenotype. The production of nuclear male sterile lines will enable conventional male lines with superior agronomic traits to be converted to female parents which then can be exploited for hybrid seed production.

KEYWORDS Brassica, male sterility, antisense, hybrid seed,

INTRODUCTION

The control of pollination is essential for production of hybrid seed. Hybrid plants grown from hybrid seed benefit from heterotic effect of crossing two genetically distinct breeding lines. The agronomic performance of the hybrid progeny is superior to both parents in terms of yield, vigour, adaptability and uniformity. In order to produce uncontaminated with self seed pollination control methods need to be developed to stop self pollination.

Unlike corn, a simple mechanical method for pollen removal is not feasible for Brassica species. Many current commercial hybrid seed production systems for field crops are based on genetic method of pollination control (Kaul 1988). Plant that are used as female parents carry defect in gene(s) controlling male fertility and thus do not produce viable pollen or are unable to cause self-fertilisation due to self-incompatibility (SI).

Developing self-incompatible breeding lines for hybrid seed production is costly since the stabilisation of inbred parental lines requires years of selfing, and the maintenance of breeding lines is labour-intensive. Other drawbacks include potential breakdown of self-incompatibility due to adverse environmental factors in the hybrid seed production field resulting in contamination of hybrid seed with selfed seed. The genetic basis of male sterility can be determined either through the cytoplasm of the cell (cytoplasmic male sterility) or by the alternation of nuclear DNA (nuclear male sterility). With the use of recombinant DNA techniques, it has become possible to engineer nuclear male sterility in crop plants.

We have previously shown that an anther-specific gene, Bcp1, isolated from Brassica campestris shows a unique pattern of expression in the diploid tapetum and haploid microspores and its expression in both cell types is essential for production of functional pollen (Xu et al 1995). This gene is conserved in members of the family Brassicaceae including Arabidopsis; 73% sequence identity at the amino acid level was found between Brassica and Arabidopsis cDNA clones Theerakulpisut et al 1991). It has been shown in the model system, Arabidopsis, that perturbing the Bcp1 gene expression using antisense approach caused male sterility. The specific downregulation of Bcp1 further demonstrated the importance of this gene during pollen development (Xu et al 1995). Transgenic Arabidopsis plants in which the Bcp1 gene is perturbed either in tapetum (using its own promoter, Bgp1) or in developing microspores (using a gametophytic promoter, Lat52 ) show arrest in pollen development leading to pollen abortion. Transgenic plants in which the Bcp1 gene is perturbed showed an inheritable male sterile phenotype. Mature pollen grains lack cytoplasmic contents and appear as empty, flattened exine shells. The transgenic plants are normal in all other respects except their inability to produce functional pollen. The induction of male sterility in the model plant Arabidopsis using Bcp1 antisense RNA has provided a new technology for the production of hybrid crop plants, that is potentially applicable for the production of hybrid seed in Brassica crops.

MATERIALS AND METHODS

Bacterial strains and plasmids: Agrobacterium strain LBA4404 was grown and maintained as described by Sambrook et al. (1989). The binary vector containing promoter-antisense Bcp1 construct has been described in details by Xu et al.(1995]. In brief, the promoter sequence was fused with 0.5 kb of Bcp1 cDNA insert in the reversed orientation and cloned into the binary vector pBI101. pBI101 also carried plant selectable marker gene, for neomycin phosphotransferase-II (NPT-II) controlled by nopaline synthase promoter (NOS Pro) and terminator sequences (NOS Ter). The resulting antisense construct was introduced into Agrobacterium.

Plant material: Commercial genotypes of oilseed rape Brassica napus and cauliflower Brassica olearacea var Botrytis were used.

Plant transformation and regeneration of transgenic plants:

Transformation and regeneration protocol of Bhalla and Smith (1998) was followed. For this, cotyledons with 1-2 mm petioles and hypocotyl sections of 2 to 3 mm in length were cut from four days old germinated seedlings and infected with Agrobacterium tumefaciens (harbouring the binary plasmid) suspension. The explants were co-cultivated with Agrobacterium for two days and transferred to callus induction medium for one week with 500 mg/l carbenicillin to inhibit bacterial growth. Explants were then transferred to shoot induction media containing 500 mg/l carbenicillin and 25 mg/l kanamycin. The green shoots that formed were carefully removed and placed into shoot outgrowth medium containing 500 mg/l carbenicillin and 25 mg/l kanamycin. Shoots that remained green on this medium were induced to root and rooted shoots were transferred to soil under glasshouse conditions.

Confirmation of transformation: PCR analysis: Polymerase chain reaction (PCR) was performed to amplify a 690bp DNA fragment of the NPT-II gene using primers that binds in the coding region of the gene (primer 1: 5'GAGGCTATTCGGCTATGACTG3' and primer 2: 5'GGAGCGGCGATACCGTAAAGC3'). The amplification products were separated by electrophoresis on 0.8% agarose gels. PCR amplified products were transferred onto Hybond N+ nylon membrane (Amersham) and hybridized with a 32P DNA probe specific for the NPT-II gene.

Southern blot analysis: Genomic DNA was extracted from leaf tissues using the CTAB method of Doyle and Doyle (1990). Fifteen mg of genomic DNA were digested with BamHI and separated by electrophoresis in a 0.8% agarose gel. The DNA was transferred onto Genescreen or Hybond N+ nylon membrane (DuPont or Amersham respectively) using a Turboblotter (Schleicher and Schuell) and hybridised with a 32P DNA probe specific for the NPT-II gene labelled by random priming (Bresatec).

RNA Blot analysis: Total RNA was extracted from anthers of transgenic and wild type control Brassica plants using the S.N.A.P. kit (Invitrogen) following manufacturer's instructions. The S.N.A.P. kit procedure allows isolation of pure RNA free from DNA contamination. RNA preparations were quantified using a GeneQuant DNA/RNA calculator (Pharmacia). Five mg of total RNA was electrophoresed and transferred onto Hybond N+ nylon membrane (Amersham). Bcp1 sense and antisense RNA were detected with (a-32P)UTP-labelled single-stranded RNA probes generated by in vitro transcription from the Brassica Bcp1 cDNA clone, as described by Xu et al. (1995)].

Pollen viability test: The fluorochromatic reaction was used as a test for pollen viability. For this, fresh pollen grains from wild-type and transformed plants were incubated in a drop of fluorescein diacetate (Sigma) solution (0.2 mg/ml final concentration in 10% sucrose) and viewed with a fluorescence microscope under UV excitation (Heslop-Harrison and Heslop-Harrison 1970). At least ten flowers from each plant were tested. After incubation for 5 minutes, viable fluorescent and non-viable dead pollen grains were counted. Data were analysed by Chi-square test.

Scanning EM: Pollen grains from dehiscing anthers were collected and viewed with a Philips scanning electron microscope.

RESULTS AND DISCUSSION

In this report we used a anther specific promoter Bgp 1 and pollen specific promoter, Lat52 to control antisense Bcp 1 gene expression. The transformation of Brassica plants with Bgp-Bcp1 antisense construct resulted in 100% pollen sterility in transgenic plants. However introduction of Lat 52-antisense Bcp1 resulted in disruption of normal pollen development in 50% pollen, thereby establishing the role of Bcp1 in controlling male fertility in Brassica species.

Antisense approach has been successfully used to downregulate expression of phenylalanine ammonia-lyase and flavonoid leading to induction of male sterility in tabacco (Matsuda et al 1996) and petunia (van der Meer et al 1992) respectively. Matsuda et al (1996) fused phenylalanine ammonia-lyase cDNA of sweet potato in the antisense and in the sense orientation with the tapetum-specific promoter of rice, Osg6B. When these chimeric genes were introduced into tabacco, a reduction (8% to 60%) in pollen fertility was observed in transformed plants carrying antisense and sense constructs. In addition, sterile pollen appeared distorted devoid of starch and flavonols and failed to germinate. The level of phenylalanine ammonia-lyase activity was positively correlated with the number of fertile pollen grains at the flowering stage. The study of Matsuda et al (1996) on tabacco clearly demonstrated that the phenylalanine ammonia-lyase activity in the anther tapetum is essential for microspore development.

In petunia, antisense inhibition of flavonoid biosynthesis in anthers resulted in transgenic plants with white anthers (van der Meer et al 1992). These white anthers were male sterile due to an arrest in male gametophyte development indicating that flavonoids play an essential role in normal pollen development. Generation of antisense mediated nuclear male sterility approach is in contrast to generation of nuclear male sterility in plant by expressing fungal ribonuclease in tapetum cells (Mariani et al 1990). The expression of ribonuclease lead to the destruction of the tapetum hence arrest in pollen development (Mariani et al 1990). While antisense mediated approach uses preturbance of the synthesis of a natural compound vital in pollen development by genetic engineering.

Results obtained in the present study using the crop plant, oilseed rape and vegetable crop cauliflower, provides an opportunity to create nuclear male sterility for hybrid seed production.. In this report we used a anther specific promoter, Bgp 1 to drive antisense gene expression. This resulted in 100% pollen sterility. The production of nuclear male sterile lines will enable conventional male lines with superior agronomic traits to be converted to female parents. For hybrid seed production in cauliflower, female parent plants can be vegetatively propagated for hybrid seed production

( Ruffio-Chable et al 1993).

For hybrid seed production in case of oil seed rape, the fertility restoration is possible if the antisense gene is controlled by an inducible promoter. In this strategy the promoter can be left in an induced state throughout various pollen development stages. A promoter that is inducible will be particularly useful since the male sterile plants can easily be maintained by self pollination in the absence inducing chemical. Moreover, the plants grown from hybrid seed in the absence of inducing chemical are expected to be fully fertile.

REFERENCES:

1. Bhalla PL, Smith N: Agrobacterium tumefaciens-mediated transformation of cauliflower, Brassica oleracea var. botrytis. Molecular Breeding (1998a, in press)

2. Doyle JJ, Doyle JI: Isolation of plant DNA from fresh tissue. Focus 12: 13-15 (1990).

3. Heslop-Harrison J, Heslop-Harrison Y: Evaluation of pollen viability by enzymatically-induced fluorescence; intracellular hydrolysis of fluorescein diacetate. Stain Tech 45: 115-120 (1970).

4. Kaul M L H: Male sterility in higher plants. Springer-Verlag. Berlin. Heidelberg. New York, 1005pp (1988).

5. Mariani C, De Beuckeleer M, Truettner J, Leemans J, Goldberg R B: Induction of male sterility in plants by a ribonuclease gene. Nature 347, 737-741 (1990).

6. Matsuda N, Tsuchiya T, Kishitani S, Tanaka Y, Toriyama K: Partial male sterility in transgenic tabacco carrying antisense and sense PAL cDNA under the control of a tapetum-specific promoter. Plant Cell Physiol. 37(2): 215-222 (1996).

7. Ruffio-Chable V, Bellis H, Herve Y: A dominant gene for mle sterility in cauliflower (Brassica oleracea var. botrytis): phenotype expression, inheritance, and use in F1 hybrid production. Euphytica 67, 9-17 (1993).

8. Sambrook J, Fritsch EF, Maniatis T: Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press. New York (1989).

9. Theerakulpisut P, Huiling X, Singh M B, Petttitt J M, Knox R B : Isolation and developmental expression of Bcp1, an anther-specific cDNA clone in Brassica campestris. The Plant Cell 3, 1073-1084 (1991).

10. van der Meer I M, Stam M E, van Tunen A J, Mol J N M: Antisense inhibition of flavonoid biosynthesis in petunia anthers results in male sterility. The Plant Cell 253-262 (1992).

11. Xu H, Knox RB, Taylor PE, Singh MB: BcpI, a gene required for male fertility in Arabidopsis. Proc Natl Acad Sci USA 92: 2106-2110 (1995).

Previous PageTop Of PageNext Page

Quick Links

Publications
Browse our extensive list of full text
[Conference Publications.....]


Conferences

47th ASL Congress
29 Sept - 3 Oct
Mandurah WA
[more...]


14th Australian Society of Agronomy Conference
21-25 September, Adelaide SA
[more...]


1st National Diversity on Boards Conference
28-29 May, Sydney NSW
[more...]


2nd National EMS Forum
19-22 May, Newcastle NSW
[more...]